Lab 2 Bio 156
Chromosome Number 12
Introduction: On the number 12 chromosome I chose eight
genes that I thought were interesting.
Of these genes I had to figure out what I was reading by defining many
words. After finding definitions I
rewrote a couple sentences summarizing each gene. I also picked my favorite gene to explore a
little more in depth.
Results: The PTPN11 gene was my favorite gene out of
the eight genes I deciphered. It was
interesting to me because it is so multifunctional. The protein this gene makes is called SHP-2
and during embryotic development is important in creating the heart, blood
cells, bones, and several other tissues.
Another interesting fact is this gene belongs to a class of genes known
as oncogenes. When this gene mutates, oncogenes have the potential to cause
normal cells to become cancerous.
Gene: PTPN11
The PTPN11 gene
carries the instructions for making a protein (SHP-2) that activates a
signaling pathway, which controls many important cell functions. Specifically during embryotic development the
protein is vital in the development of heart, bone, blood cells, and other
tissues. If mutations occur in this gene then acute myeloid leukemia or Noonan syndrome can occur. (http://ghr.nlm.nih.gov/gene/PTPN11,
accessed 6 March 2012)
Gene: PAH
The PAH gene gives instructions for
making an enzyme called phenylalanine
hydroxylase. The enzyme is responsible
for the first step in processing phenylalanine which is a “building block” of
protein received through food. (http://ghr.nlm.nih.gov/gene/PAH, accessed
27 Feb 2012) There are mutations that occur in this
gene. There are over 500 different PAH
gene mutations that have been identified in people with phenylketonuria. Phenylketonuria is a rare condition in which a baby is born
without the ability to properly break down an amino acid called
phenylalanine. Phenylalanine plays a
role in the body's production of melanin, the pigment responsible for skin and
hair color. (http://health.yahoo.net/channel/phenylketonuria.html , accessed 27 Feb 2012)
Definitions
HYDROXYLASE: any of a group of enzymes that catalyze oxidation reactions in which one of the two atoms of molecular oxygen is incorporated into the substrate and the other is used to oxidize NADH or NADPH (http://www.merriam-webster.com/dictionary/hydroxylase, accessed 29 February 2012)
Phenylalanine
catabolism: Protein involved in the degradation of the
aromatic amino acid phenylalanine. (http://www.uniprot.org/keywords/KW-0585 , accessed 28 Feb 2012)
Phenylketonuria is caused by mutations in the
PAH gene. (http://ghr.nlm.nih.gov/gene/PAH, accessed 27 Feb 2012)
Phenylketonuria is a rare
condition in which a baby is born without the ability to properly break down an
amino acid called phenylalanine.
Phenylalanine plays a role in the body's production of melanin, the
pigment responsible for skin and hair color. (http://health.yahoo.net/channel/phenylketonuria.html , accessed 27 Feb 2012)
Gene: IFNG
The IFNG gene is
part of the type 2 interferon family. The protein molecules in this gene help
to regulate the immune system and activate white blood cells that protect the
body against infection and foreign substances. (http://medical-dictionary.thefreedictionary.com/Macrophages, accessed 29 Feb
2012)
Definitions
macrophages are white blood cells (activated
monocytes) that protect the body against infection and foreign substances by
breaking them down into antigenic peptides recognized by circulating T cells.
Cytokine are small
cell-signaling
protein molecules
that are secreted by numerous cells and are a category of signaling molecules used extensively in
intercellular communication. Cytokines can be classified as proteins, peptides, or glycoproteins;
the term "cytokine" encompasses a large and diverse family of
regulators produced throughout the body by cells of diverse embryological origin.[1]
(http://en.wikipedia.org/wiki/Cytokine , accessed 29
February 2012)
Aplastic anemia is a
condition where the bone
marrow does not produce enough, or any, new cells to
replenish the blood cells.
(http://www.wordiq.com/definition/Aplastic_anemia,
accessed 29 February 2012)
interferon is of a
family of glycoproteins, production of which can be stimulated by viral
infection, by intracellular parasites, by protozoa, and by bacteria and
bacterial endotoxins, that exert antiviral activity and have immunoregulatory
functions; they also inhibit the growth of nonviral intracellular
parasites. (http://medical-dictionary.thefreedictionary.com/interferon,
accessed 1 March 2012)
Gene: UBC
The UBC gene makes a protein called ubiquitin
that consists of 76 amino acids.
This protein is part of the eukaryotic
species. It
has a key feature of a C terminal tail and is well-preserved
among eukaryotic species. (http://en.wikipedia.org/wiki/Ubiquitin,
accessed 1 March 2012)
Definitions
Ubiquitination: The
"kiss of death" process for a protein.
In ubiquitination, a protein is inactivated by attaching ubiquitin to it.
Ubiquitin is a small molecule.
Monomer is a
molecule that forms the basic unit for polymers. Monomers may bind to other
monomers to form a repeating chain molecule. ( http://chemistry.about.com/od/chemistryglossary/g/Monomer-Definition.htm,
accessed 1 March 2012)
Ubiquitin
C
(n): A single protein comprised of
tandem repeats of the UBIQUITIN 78 amino acid sequence. It is a product of the polyubiquitin gene which contains multiple copies of
the ubiquitin coding sequence. Proteolytic processing of ubiquitin C results in
the formation of individual ubiquitin molecules. This protein is distinct from POLYUBIQUITIN, which is a protein formed
through isopeptide linkage of multiple ubiquitin species. (http://www.medical-dictionary.cc/what-does/ubiquitin-c-mean, accessed 28 Feb 2012)
Gene: VWF
The purpose of
the protein encoded by the VWF gene is for aiding in blood clotting. The name
of this protein is glycoprotein. Hemophilia is usually caused by a deficiency
of this protein and mainly effects men. Von
Willebrand disease (VWD) is a bleeding disorder caused by this gene that affects
both men and women. Von Willebrand
disease is quite common, happening in approximately 1 in 100 people. (http://www.nhlbi.nih.gov/health/health-topics/topics/vwd/, accessed 29 Feb 2012)
Definitions
Von Willebrand disease (VWD) is a bleeding disorder. It affects your blood's ability to clot. If your blood doesn't clot, you can have heavy, hard-to-stop bleeding after an injury. The bleeding can damage your internal organs. Rarely, the bleeding may even cause death. (http://www.nhlbi.nih.gov/health/health-topics/topics/vwd/, accessed 29 Feb 29 2012)antihemophilic factor is a protein substance in blood plasma that participates in and is essential for the blood-clotting process. Most cases of hemophilia are caused by a deficiency of this factor. (http://www.thefreedictionary.com/antihemophilic+factor, accessed 29 Feb 2012)
Pseudogene: A
defective segment of DNA that resembles a gene but cannot be transcribed. (http://www.answers.com/topic/pseudogene,29 Feb 2012)
Hemostasis: The
stoppage of bleeding or hemorrhage. Also, the stoppage of blood flow through a
blood vessel or organ of the body. ( http://www.medterms.com/script/main/art.asp?articlekey=15839,
accessed 29 Feb 2012)
Gene: CD4
The CD4 gene produces a protein that has a
carbohydrate as the nonprotien. This
gene is in many parts of the body including parts of the brain. The protein initiates the early phase of
T-cells and is important in recognizing problems with the immune system. (http://www.ncbi.nlm.nih.gov/gene/920,
accessed 1 March 2012) HIV uses the CD4
gene to gain access to host T-cells and does this by binding the protein to a
co-receptor on the host cell. (http://en.wikipedia.org/wiki/CD4,
accessed 1 March 2012)
Definitions
Granulocytes: A type of
white blood cell filled with microscopic granules that are little sacs
containing enzymes, compounds that digest microorganisms. Granulocytes are part
of the innate immune system and have somewhat nonspecific, broad-based
activity. They do not respond exclusively to specific antigens, as do B-cells
and T-cells. (http://www.medterms.com/script/main/art.asp?articlekey=8780,
accessed 28 Feb 2012)
Histocompatibility: A state or condition in which the
absence of immunologic interference permits the grafting of tissue or the
transfusion of blood without rejection. (http://medical-dictionary.thefreedictionary.com/histocompatibility, accessed 28 Feb 2012)
CD4 continues to be expressed in most neoplasms
derived from T helper cells. Neoplasm is an abnormal mass of tissue as a
result of neoplasia. (http://en.wikipedia.org/wiki/Neoplasm,
accessed 28 Feb 2012)
T cells or T lymphocytes belong to a
group of white blood cells known as lymphocytes,
and play a central role in cell mediated immunity. (http://en.wikipedia.org/wiki/T_cell, accessed 28 Feb 2012)
Glycoproteins is any group of conjugated proteins having a
carbohydrate as the non-protein component. (http://www.thefreedictionary.com/glycoprotein,
accessed 29 Feb 2012)
HIV (human
immunodeficiency virus) uses CD4 to gain entry into host T-cells and
achieves this by binding of the viral envelope protein known as gp120 to CD4.
The binding to CD4 creates a shift in the conformation of gp120 allowing HIV-1 to
bind to a co-receptor expressed on the host cell.
(http//en.wikipedia.org/wiki/CD4, accessed 28 Feb 2012)
Gene: KRAS
The KRAS gene provides the instructions for
making the K-Ras protein that’s main function is regulating cell division. This gene belongs to a group of genes called
oncogenes that when mutated become potentially cancerous. (http://ghr.nlm.nih.gov/gene/KRAS, accessed 28 Feb 2012)
DefinitionsMalignancies: a malignant tumor; cancer. (http://www.yourdictionary.com/malignancies, accessed 1 March 2012)
Mucinous tumors (or mucinous tumours) are part of the surface
epithelial-stromal tumor group of ovarian neoplasms, and account for 12-15% of
all ovarian tumors. (http://en.wikipedia.org/wiki/Mucinous_tumor, accessed 1 March 2012)
C-terminal: the end of the peptide chain carrying the
free alpha carboxyl group of the last amino acid, conventionally written to the
right. (http://medical-dictionary.thefreedictionary.com/C-terminal, accessed 1 March 2012)
Adenocarcinoma is a type
of cancer that affects the lung. (http://www.ehow.com/about_5453150_adenocarcinoma-definition.html,
accessed 1 March 2012)
mammalian - any warm-blooded vertebrate
having the skin more or less covered with hair; young are born alive except for
the small subclass of monotremes and nourished with milk. (http://www.thefreedictionary.com/mammalian,
accessed 1 March 2012)Oncogenes: The KRAS gene belongs to a class of genes known as oncogenes. When mutated, oncogenes have the potential to cause normal cells to become cancerous. The KRAS gene is in the Ras family of oncogenes, which also includes two other genes: HRAS and NRAS. The proteins produced from these three genes are GTPases. These proteins play important roles in cell division, cell differentiation, and the self-destruction of cells (apoptosis). (http://ghr.nlm.nih.gov/gene/KRAS,accessed 1March 2012)
Gene:
SP1
The protein produced by the SP1 is involved in
several cellular processes including cell growth and responses to DNA
damage. This gene has a zinc finger
transcription factor binding it to a specific amino acid sequence called the
GC-rich motif. (Zinc fingers are folds created in a protein by binding of
specific amino acids to a zinc atom). These folds are called zinc fingers and
they help in the interaction with DNA and RNA. http://www.biology-online.org/dictionary/Proteolytic,
accessed 29 Feb 2012)
DefinitionsGC-rich motifs: A nucleic acid sequence that contains an above average number of GUANINE and CYTOSINE bases. (http://www.biology-online.org/dictionary/Proteolytic, accessed 29 Feb 2012)
Phosphorylation: the process of attaching a phosphate group to
a protein, sugar, or other compound. (http://medical-dictionary.thefreedictionary.com/phosphorylation, accessed 1 march 2012)
Glycosylation: The
addition of glycosyl groups to a protein to form a glycoprotein. (http://medical-dictionary.thefreedictionary.com/glycosylation,
accessed 1 march 2012)
Acetylation:
A reaction, usually with acetic acid, that introduces an acetyl radical into an
organic compound. (http://medical-dictionary.thefreedictionary.com/acetylation,
accessed 1 march 2012)proteolytic :1. Pertaining to, characterized by or promoting proteolysis. 2. An enzyme that promotes proteolysis (= the splitting of proteins by hydrolysis of the peptide bonds with formation of smaller polypeptides). (http://www.biology-online.org/dictionary/Proteolytic, accessed 1 March 2012)
Conclusion: The human genome project is so complex and
amazing. All the information that makes
us who we are is stored in 23 chromosomes.
Mapping the many thousands of genes is still being worked on and will take
some time for scientists. This project
was interesting because I felt like I was helping to decipher the genes on chromosome
number 12.
My DNA Strand
Introduction: The objective of this assignment is to take a
section of a DNA strand and translate it into mRNA. Then take the RNA and translate it into a
polypeptide. After that is complete build
a DNA model out of basic household materials.
Procedure: To
better understand DNA I took a DNA sequence and translated it into RNA. I had to re research to make sure I was translating
it correctly and got the hang of it. It
again took some time to translate the RNA into amino acids of a
polypeptide. After I accomplished this I
then began building everything back up to a DNA model. I feel by doing this I learned a lot because it
usually takes some time taking things apart but is easier to put them back
together afterwards.
The materials I used
to make my DNA model were four different colors of pipe cleaners to form the
organic base pairs thymine, cytosine, adenine, and guanine. Two pieces of 8” long thin wire used for making
the side rails. Two different color
beads to represent the deoxyribose and phosphoric acid forming the rails of the
DNA strand.
First I made the side rails of my DNA strand. I did this by stringing the two different
color beads (deoxyribose and phosphoric acid) alternately on the two eight inch
pieces of wire. After this was complete I
used my ten amino acids I had already deciphered and used them as a guide to
build my DNA model. I translated the
amino acids back into DNA and used one color of pipe cleaner to represent each
base. Using the corresponding base pairs
(pipe cleaners) I created the rungs of the DNA ladder. After I had the DNA ladder completed I twisted
the side rail wire into a helix formation to complete my DNA model.
Results:
My original DNA sequence:
TTCCTGTCTGTTGGTCGTTCTCTGATGCTGCCAGCCACTTGTGCTGCTGTTCTCCCCTCTCCTTCCACTT
My RNA:
AAGGACAGACAACCAGCAAGAGACUACGACGGUCGGUGAACACGACGACAAGAGGGGAGAGGAAGGUGAA
Ten amino acids:
AAG GAC AGA CAA CCA GCA UAC GGG AGG GGA
Amino Acid 1: Lysine (lys) Amino Acid 6: Alanine (ala)
Amino Acid 2: Aspartic acid (asp) Amino Acid 7: Tyrosine (tyr)
Amino Acid 3: Arginine (arg) Amino Acid 8: Glycine (gly)
Amino Acid 4: Glutamine (gin) Amino Acid 9: Arginine (arg)
Amino Acid 5: Proline (pro) Amino Acid 10: Glycine (gly)
 |
| The rails of my DNA model on the left. The bases shown with the pipe cleaner that represents them on the right. |
 |
| The natural base pairs of DNA. The colors silver and red represent thymine and adenine complimentary base pairs. The colors blue and green represent cytosine and guanine complimentary base pairs. |
 |
| The natural base pairs (pipe cleaners) connected to the deoxyribose and phosphoric acid (two colored beads) making up the ladder of my DNA model. |
 |
| My finished DNA model. |
The DNA model I built represents central dogma because I went through the whole process. This dogma forms the backbone of molecular biology by transcription of DNA to RNA then to protein. First in replication DNA duplicates its information. Second DNA codes for RNA to synthesize in transcription. Third the mRNA is processed by a process of splicing. Lastly in the process of translation the mRNA carries coded information to the ribosomes used in protein synthesis.
Conclusion: I found building a DNA model was more
difficult than I had expected. You had
to make sure everything was in order and that adenine and thymine were together
and cytosine and guanine were together.
I now feel I have a better understanding of DNA after doing this
project.
